I have a fasta file with multiple headers:
`>contig00001_len=155988_cov=17.1_corr=0_origname=NODE_1_length_155988_cov_17.103139_sw=shovill-spades/1.1.0_date=20240120
AATTCTAACAGGTCAGATATTTCTACAATAGCATCGCGAATACCACCAATATA

Bash Shell script to replace the third value to zero if it has no value or empty.
values are closed by #^#^, seprated by pipe and records are terminated with new line
My file have so many lines ,so if any record/line of 3rd string/value contains empty or null needs
to be replaced by zero 0.
#^11abc27#^|#^x26729#^|#^#^|#^82.41#^|#^173#^|#^yx Corportaion#^
want change to
#^11abc27#^|#^x26729#^|#^0#^|#^82.41#^|#^173#^|#^yx Corportaion#^

I created the following sed in order to add the python command – exit() before the line LIST_ALL_SELECT_TOOL_PACKAGES_CMD in the file – yumrpm.py

I have an yaml object like below

I have this sed expression:

In sed, how do I remove everything behind each @ in a string, as long as that does not contain a /?

How do I print all lines from the first line of a file up to and including the first matched line?

I use sed to replace digits regex capture group.
How to use d with sed?
This works:

I am trying to use sed to grab file path, line number, compiler warning number and warning message but I am failing.

I have some text that I need to remove some dots
The file has multiple lines, and I want to change only the ones more or less like these, other lines should be untouched