I’m just a beginner on machine learning and I’ve watched tutorial videos on YouTube in order to come up with my code. Our professor has only given us less than a week to learn and complete this without teaching us anything. I’ve only been asking for help from AIs because it’s getting harder.

!pip install skater

!pip install skater

I am running this notebook in my pc
this notebook deals with audio-classification using wav2vec2 base model

Why does my code get this error,My code is as follows:`

I have a sequence of DNA ,I want to transform this sequence to another list of numbers using a methods of AI .
Example:
S=[ACGCACGCAGCCGACGCAGCACCAAGCAGCAG]

I’m very new to this field, I’m currently learning about neural networks and I’ve came across CNN (Convolution Neural Network) but I see some people use Siamese network for image data instead

I want to make a forecasting system which will forecast how much quantity will be sold next year based on the previous 5 years data from 2019 to 2023 and want to predict for future years. Now the problem is my data contains product name product category quantity and date but in form of jan, feb and march not start or end date. But im struck on what to do if I make separate models for each product which isnt suitable at industry level like I have 40 plus producs so thats not suitable. My product name and category name is reoeated like product A, category A, date for example Jan 2019, quantity 60, then feb 2019 product A, category A quantity 70 this way. So, I need suggestions what can I do for it.

We all know that in machine learning, we often don’t perform data processing and feature engineering steps on the entire dataset and all its columns.